lunes, 30 de noviembre de 2009

Maruxa en Sabadell: "Qué dulce sueño, para la pastora tiene su pastor"

Ayer por la noche, a las nueve y algunos minutos, se alzaba el telón del Teatre Municipal de la Faràndula de Sadadell y se desvelaba el misterio y la duda surgida seis meses atrás desde que se anunció la nueva temporada dels Amics de l´Òpera de Sabadell: ¿habría o no oveja?. Pues sí, la hubo... pero de peluche.
La verdad, no fue una sorpresa puesto que en la prensa local del mismo día venía una fotografía de la producción que ya anunciaba la oveja de peluche y dejaba adivinar un poco como resultaría la puesta en escena y el vestuario.



La obra que se representaba ayer en el teatro vallesano era la muy poco anunciada “Maruxa”. Y digo poco anunciada porque, a excepción del cartel en el teatro que ya hace varios días que está colgado, o la propaganda en el “Diari de Sabadell”, en esta ocasión no se decantaron, com casi siempre acostumbran a hacer desde l´A.A.O.S, por las banderolas colgadas en los árboles de la Rambla. Ignoro si lo estaban en algún otro punto de la ciudad, pero por el centro no había. De todas maneras, y desde un punto de vista personal, yo no las necesitaba ¿por qué cómo no iba a acordarme que se representaba esta obra?. Hacía como digo, más de seis meses que la esperaba con muchas ganas.




“Maruxa”, junto con “Doña Francisquita” , “Bohemios” y “La Generala”, es una de las obras caudales del compositor catalán Amadeu Vives, que por su envergadura, estructura y falta de diálogos (almenos en la versión sabadellense) casi podría considerarse más cerca de la ópera que del propio género zarzuelístico, con una, más que ligera proximidad, al verismo quizás por la densa y pesada orquestación de la obra.
He de decir que para la ocasión, y como me gusta mucho la zarzuela, decidí ir a las dos representaciones que se ofrecen en nuestra ciudad, la del viernes, que era el estreno, pero también a la del domingo por la tarde, y creo sinceramente que acerté al tomar esta decisión y explicaré el por qué inmediatamente.
Pero Sabadell no es la única ciudad que acogerá este montaje, ya que se podrá también disfrutar, eso sí, ya en el 2010, en el Atrium de Viladecans el día 22 de enero a las 9 de la noche y en el Teatre Auditori de Sant Cugat el 24 de enero a las 7 de la tarde, e imagino, que esta será la función que se retransmitirá por Catalunya Música. Así es que ya saben, si tienen ganas de ver el montaje, a lo mejor aún queda alguna entradita (lo desconozco).
Centrémonos pues en el tema que nos ocupa. La Faràndula llena, muchas ganas de zarzuela, mucha ilusión pero nada más empezaron a cantar me llevé una desilusión: la orquesta sonaba TAN fuerte que hacía inaudibles a los cantantes que durante el primer acto tuvieron que luchar contra su sonoro oleaje que no dio tregua durante los primero 65 minutos. Además, por si fuera poco, detrás nuestro, teníamos una pareja que se pasó la noche hablando a volumen par nada bajo y riendo con algunos de los elementos de la escena.
Entre una cosa y otra impedieron mí concentración total en la música, en el escenario y en el momento. Y francamente, un directo con estas características impide gozar del instante mágico e único que solo el directo, valga la redundancia, es capaz de hacerte sentir. Así es que mí primera crítica va dirigida a la Orquesta Simfònica del Vallès dirigida en esta ocasión por el maestro DANIEL MARTÍNEZ.


El maestro no supo, en mí opinión, llevar las riendas de la desbocada Simfònica del Vallès. Volumen y más volumen, y aún más volumen, desembocaron en un primer acto, almenos el viernes por la noche, inapreciable, con los cantantes sufriendo y sacando toda la voz posible para poder ser valorados. No sé si la gente de los pisos o del final de platea oían las voces, lo ignoro, pero desde primera fila era casi imposible hacerlo.
Y no era problema de un cantante en concreto, sinó que todo el elenco se vio perjudicado por esta inusual interpretación de la obra. Ya sabemos que el fosado de la Faràndula es el que es y que el teatro en sí no es el adecuado para acoger óperas y zarzuelas por su deficiente cústica, pero, a pesar de estas circunstancias, es el director de orquesta quien tiene que solventar esta situación, haciendo sonar la orquesta más suave, por debajo del cantante, ya que en definitiva, es la orquesta quien acompaña al cantante y no vice-versa.
Cuando salió al principio del segundo acto para interpretar el pasaje orquestal hubo gente que manifestó su inconformidad.
Sin embargo, cuando esperábamos que en este preciso momento la orquesta alcanzaría sus cotas máximas de volumen, el maestro supo dosificarlo mucho mejor logrando una interpretación, no antológica, pero muy digna y precisa que fue bastante aplaudida y con algún que otro “bravo” procedente del final de la platea.
Supongo que se daría cuenta de esta situación, ya que durante el segundo acto, aunque en algún pasaje hubo algún abuso de volumen, Daniel Martínez suavizó un poco a los músicos y logró con ello, a ratos, el efecto deseado para que el público gozara de la música. Y fue en la romanza de Pablo “Ven meu amor” cuando el público logró estar en comunión con el cantante, con una orquesta suave, por debajo del intérprete, como un susurro de aire en la noche en la que la voz de Pablo se metía en los corazones del oyente.
Esperemos que en la función del domingo corrija este incidente y podamos apreciar, como se merece, la obra y los cantantes.
Y realmente así fue, en la función de ayer por la tarde la orquesta bajó el tono durante toda la obra, lo que nos permitió gozar de las voces de los intérpretes con un acompañamiento musical adecuado.


Antes de empezar a hablar de la parte vocal, es justo que demos un repaso a la escenografía, iluminación y vestuario.


Dos conocidos de la casa, CARLES ORTIZ y JORDI GALOBART fueron los que asumieron el cometido de convertir el escenario vallesano en un prado gallego. Y siempre decimos lo mismo, la Faràndula tiene por defecto pocos recursos escénicos, pero el tándem Ortiz-Galobart funciona y con una escena sin apenas elemento alguno consiguen crear la ilusión en el espectador, dominando los colores verdes para simular un prado, recurso poco imaginativo pero resultón.
La iluminación de NANI VALLS fue como siempre excelente, sobretodo en la última escena de la obra cuando es de noche, con unos colores azules marinos y una más que ténue luz lunar que creaba muy bien el ambiente, igual que en los relámpagos que desde “Il Pirata” del mes pasado ya vienen convirtiéndose en sello de autenticidad de la casa.
Por lo que se refiere al vestuario, que firma la propia A.A.O.S, quizás un poco moderno para simular que la acción trascurre en la Galícia rural durante el s.XIX, pero a pesar de esto, se adecuaba bastante a la acción que se narra.
Acertadísimo, para dar este “toque” de modernidad deseado, el conjunto del primer acto que lucía la soprano Elisa Vélez, pantalón marrón y ancho, ajustado en la cintura, camisa blanca con gorro y fusta que le daba una imagen de amazona. Estaba realmente muy guapa.
Dejando de lado estos tres elementos, me sorprendió una cosa: a pesar de ser una obra cantada en castellano (con algunas pinceladas de gallego) el Teatro ofreció el servicio de sobretitulación... quizás para aquellos que querían hacer “karaoke”... En serio, se hizo raro porque el texto se entendía (en aquellos instantes en que la orquesta apaciguó el volumen). No deja de ser una mera anécdota, y supongo que pensaron en este recurso para hacer entendedor al público los fragmentos cantados en gallego y acabaron por ofrecer el servicio en toda la obra.


Pasemos, ahora sí a ocuparnos de la parte vocal.


MAITE ALBEROLA fue la encargada de dar vida a la pastora Maruxa, a pesar de que en un primerizo momento se anunció que lo cantaría Anna Tobella.
Es una voz interesante, con volumen y cuerpo, y también con bastante buena dicción, cosa que en las voces de soprano es difícil de encontrar. Aún así “pecó”, y no es solamente problema de ella sino de todos los intérpretes debido al volumen exagerado de la orquesta, a cantar bastante “forte”, sacando mucho la voz, lo cual no le favorecía nada porque daba la sensación como de estar gritando.
No es la típica voz de soprano muy aguda, no, la de Alberola es una voz con cuerpo, quizás aún por hacer. Apunta cosas buenas que, de encontrar un buen acompañamiento orquestal, hubiera dado mucho más de sí.
Escénicamente como Maruxa estubo creíble al igual que el resto de sus compañeros, suelta en escena.
En la interpretación del domingo por la tarde, aunque ya me lo había parecido en la del viernes por la noche, pude apreciar mucho más la vocalización de Maite Alberola, y concretamente me fijé en su manera de pronunciar las “m”, con intensidad e intención, realmente sintiéndolo.


El papel de prima Rosa fue interpretado por otra conocida de la casa, la soprano canaria ELISA VÉLEZ, y fue una de las voces que más se resintió al tener que luchar con el volumen orquestal, ya que su voz ligera, que va al dedillo con el papel de Rosa, sufría al enfrentarse al son inadecuado de la Sinfónica del Vallès, sin embargo con su profesionalidad sacó, con nota, adelante el papel.
A pesar de esto, la voz está y las notas también estuvieron allí (las que pudimos apreciar). Además, escénicamente fue una de las mejores, a pesar que el enfoque psicológico que le dieron a ella, y también al capataz Rufo, no me acabaron de convencer.
Es verdad que si tenemos en cuenta que la obra la modernizaron un poco la interpretación artísitica no desfina tanto con lo visto, pero no debemos olvidar que Rosa viene de un entorno social diferente al de los pastores y al de Rufo. Rosa es una chica de alta sociedad, acostumbrada a tener colmados todos sus caprichos y a tratar de manera distante a los criados. Por esto no me convence que cuando explica a Rufo que vio a Pablo y que se enamoró de él sienten a Rufo en la piedra y ella por detrás lo “desmonte” haciédolo inclinar a derecha, a izquierda, sacándole el sombrero como si Rufo fuera un títere en sus manos.
El resto de sus impacientes y nerviosos movimientos daban vida a su personaje, pero, en mí modesta opinión , creo que no cuadra con su posición social, más bien fría.
A pesar de esta opinión a nivel personal, fue una de las intérpretes más aplaudidas en la ronda de aplausos del viernes por la noche y creo que no solamente por su calidad vocal, también por su expresión de cara y ojos, revelándose como una muy buena actriz que estaba actuando en todo momento, incluso cuando no cantaba.
En la función del domingo por la tarde pude fijarme mucho más en ella a nivel vocal debido a que la orquesta no sonaba tan fuerte, y realmente dejó muy buenos detalles de fraseo y expresión, mejorando, sin duda, su actuación del viernes por la noche.
El personaje de Pablo fue interpretado por el barítono CARLES DAZA, también conocido de la casa desde que hiciera su debut profesional en el año 2005 con el papel de Silvio en la ópera “I Pagliacci”.
Sinceramente pienso que cada vez que lo escucho está mejor de voz, más rodado, no sólo a nivel vocal, sinó también a nivel escénico. Precisamente en la función del viernes por la noche lo encontré muy relajado escénicamente, muy metido en el personaje, natural y suelto, nada forzado como si realmente él fuera un pastor enamorado de Maruxa.
Siempre me ha parecido que el papel de Pablo no es muy agudo a pesar de que pueda tener alguna nota un tanto comprometida, sinó que es un papel, a la par, “bombón” para el barítono y que una de las cosas imprescindibles para afrontarlo es que el barítono “sepa cantar”, me explico.
Con ello quiero decir que, a pesar de tener las notas, debería tener también un fraseo elegante y, además si le añadimos la escena, es importante, aunque no determinante para ser un buen Pablo, que tuviera una presencia escénica creíble. Y estos dos elementos pienso que Carles Daza los reúne porque realmente el viernes por la noche “vi” al pastor Pablo, no al cantante que intentaba ser el personaje.
De toda la velada, lo más audible sin interrupciones que pudimos apreciarle fue su romanza final “Ven meu amor” donde cosechó unos merecidos bravos del público más enfervecido.
Tuvo que, al igual que sus compañeros, luchar contra el volumen de la orquesta, lo que provocó que sus primeras notas “Herido del mal de amores” se hicieran inaudibles, entre otras cosas porque está cantado desde dentro del escenario, pero a medida que iba avanzando el dúo inicial con Maruxa se hizo más presente su voz porque adoleció, como sus colegas, de empezar a cantar más “forte” por exigencias orquestales, y no por gusto, me imagino.
Vestuario senzillo para el pastor que le daba un toque muy juvenil, casi de niño adolescente. Y es que Daza es joven, pero el viernes aún lo parecía mucho más, por actitud, por juguetonería, por expresión, por las reacciones de su cara y ojos... Sí, también era uno de los que estaban guapos.
En la función del domingo pudimos apreciar de nuevo su voz, estupenda en todas sus intervenciones arrancando de nuevo unos ruidosos bravos en su romanza final. También destacar su dúo final con Maruxa, donde la voz sonó firme bella y con ganas. Fue también, al igual que el viernes por la noche, uno de los más aplaudidos.





Hago un pequeño paréntesis antes de continuar con el resto del elenco vocal para comentar que todos los intépretes daban la imagen del personaje, y esto ya es importante (exceptuando quizás, si queremos ser un tanto quisquilosos, el que daba vida a Rufo, que a pesar de llevar las sienes polvoreadas de blanco, se veía muy joven para Rufo, porque me imagino un capataz con muchos más años, un hombre ya curtido de los prados gallegos).


ALEXIS TREJOS dio vida, precisamente, al capataz Rufo, el “celestino” de la obra que “arregla” los amores de los pastores y da con la puerta en las narices a los “señoritos”.
Voz más que interesante, quizás faltada (a gusto mío) de un poco más de grave, pero debe reconocerse que lo hizo muy bien, aunque a excepción del conocido “Golondrón”, es un papel para nada alto y sin compromiso, a pesar de ser uno de los personajes que más están en la escena.
Cómo decía antes, la interpretación escénica que se le atribuyó no me convenció porque para mí Rufo es un hombre de principios y creo que serio, rural, sí, pero no olvidemos que es un rudo capataz, por tanto esos andares “tan” campechanos me descolocaron un poco, porque Rufo no es un “pallasín” sino alguien que vela por las buenas maneras y formas.
Sin embargo y a pesar de lo anterior y quizás porque ya la había visto el viernes, el domingo por la tarde no me importó ese enfoque, e incluso pensé: “¿y por qué no? Es una interpretación que no deja de crear su efecto, porque si dándole un toque de seriedad, Rufo es uno de los personajes más queridos de “Maruxa” porque está al lado de los “buenos” que sufren las injustícias de las clases sociales adineradas, quizás con esta senzillez rústica que el director de escena le marca, se hace, a la par, mucho más simpático”.
Cabe destacar también que escénicamente, tanto el viernes como el domingo fue, la escena la hizo más qué bien.


MARC SALA encarnó al primo Antonio con una bonita y elegante línea de canto que ya dejó entrever el viernes por la noche. Una lectura de la carta bien fraseada y con unas notas agudas bien colocadas, fue uno de los más aplaudidos el viernes.
Y por lo que respeta al domingo por la tarde, quizás porque ya estaba más relajado, nos ofreció de nuevo una voz impoluta claramente de tenor con sonoridades mucho más que interesantes.


Breve comentario para la correcta interpretación de la mezzo LAURA VILA en el papel de Eulalia.


Debemos destacar la lograda interpretación dels Cors dels Amics de l´òpera de Sabadell, sobretodo en la escena de jolgorio del segundo acto, cantando además en gallego.


Mención también de agradecimiento al “Irmandade Galega de Rubí” y al “Centro Galego Nos de Sabadell” que aportaron a la obra las pinceladas de folclore gallego con la gaita y el tamboril, así como el breve ballet.


Resumiendo, unas buenas funciones que estoy segura que en las dos que faltan para enero, mejorarán aún más. A los que acudan a Viladecans y a Sant Cugat les auguro unas representaciones de una alta calidad que espero que disfruten tanto como yo he disfrutado este fin de semana.


Ah, y por cierto… yo quiero la ovejita de Maruxa cuando terminen las funciones. Queda el deseo expresado.


Próxima cita en la Faràndula, “Carmen” a finales de febrero.

viernes, 27 de noviembre de 2009

Ay Maruxa danza muy ligera, danza, danza, alegre y a compás...


Esta noche se estrena en el Teatre Municipal de la Faràndula de Sabadell el segundo título de la Temporada de Ópera dels "Amics de l´Òpera de Sabadell". La obra escogido para la ocasión es la zarzuela "Maruxa" del maetro Vives.

Las voces que darán vida a los personajes serán la soprano Maite Alberola como Maruxa, el barítono Carles Daza como Pablo, Elisa Vélez como Rosa, el tenor Marc Sala como Antonio y Alexis Trejos como Rufo todos ellos dirigidos por el Maestro Daniel Martínez.

La dirección de escena corre a cargo de Carles Ortiz y la escenografía de Jordi Galobart, dos conocidos y habituales de la casa.
Ya os contaré mis impresiones.

lunes, 23 de noviembre de 2009

Ay mí morena, morena clara...

Junto a la popularizada "No puede ser" de "La Tabernera del puerto" del maestro Sorozábal que escuché por primera vez en el Concierto de los Tres Tenores en Caracalla, el "Coro de los Vareadores" de la "Luisa Fernanda" de Moreno Torroba y el "Fiel espada triunfadora" de "El huésped del sevillano" del maestro Guerrero, fueron las primeras romanzas de zarzuela que empezaron a sonar en mí voz de estar po casa.
Piezas senzillas que me "llegan" y que me apasionan. Quizás porque ayer tenía día de "Luisa", no sé, pero esta mañana me he levantado con el "Ay mí morena, morena clara, ay mí morena qué gusto da mirarla"... que tan bién canta Plácido Domingo, con esos colores broncíneos de su voz que tanto adoro.
El "Coro de los Vareadores" fue la primera romanza que copié a mano y que hoy en día aún conservo, y porque para mí en aquel momento era importante aprender la música pero también la letra. Y en una época en que los ordenadores aún no habían invadido nuestra vida cotidiana, pues no quedaba otro remedio que escribirla a mano.
El vídeo que os propongo es de una "Gala de Reyes", la primera "Gala de Reyes" que tuvo lugar el día 5-1-91. Allí descubrí otra zarzuela, y muchas más, que nada tenían que ver con aquél "No puede ser" de Roma que tanto me había impresionado. La zarzuela entraba de lleno en mí vida, convirtiéndose en uno de las músicas que más adoro y disfruto.

¿Ay! Mi morena, morena clara (Vidal y coro de vareadores)

CORO

Si por el rido, si por la vera,

si por el rido, se fue la mi morena.

Sin mi morena. Morena clara,

sin mi morena, no sirvo ya pa nada.

VIDAL

Bienvenidos los vareadores.

CORO

Dios os guarde, señor don Vidal.

VIDAL

Ya que alegres venís y cantando,

con vosotros yo quiero cantar.

Cantar mis amores, pues me enamoré.

CORO

Amores que cantan, acaban en bien.

VIDAL

En una dehesa de la Extremadura,

tengo una casina blanquina y chicuca.

Parece un palacio mi pobre casina,

pues guarda una moza como una infantina.

Me llena de gozo saber que la moza,

me aguarda y me espera contando las horas;

pensar que la tratan igual que a una reina,

y ser en mis prados el rey que la espera.

¡Ay mi morena, morena clara!

¡Ay mi morena, que gusto da mirarla!

Toda la vida mi compañera,

toda la vida será la mi morena.


CORO

¡Ay mi morena, morena clara!

¡Ay mi morena, que gusta da mirarla!

¡Ay! ¡Ay! ¡Ay! ¡Ay!

VIDAL

Por los encinares de la dehesa,

los vareadores van a su faena.

Por los encinares voy en mi caballo,

pa ver a la moza que me ha enamorado.

Será, si Dios quiere, el ama y señora,

de mis encinares y de mi persona.

Y de los pastores de la dulce gaita,

que harán las delicias de la soberana.

¡Ay mi morena, morena clara!

‘Ay mi morena, que gusto da mirarla!

Toda la vida mi compañera,

toda la vida será la mi morena.

CORO

¡Ay mi morena, morena clara!.

‘ay mi morena, que gusto da mirarla!

VIDAL

Toda la vida mi compañera,

toda la vida, será la mi morena

¡Ah! ¡Ah! ¡Ah! ¡Ah!

martes, 17 de noviembre de 2009

Entrevista a Plácido Domingo

Interesante entrevista a Plácido Domingo firmada por Mirentxu Mariño. Os dejo el enlace y copio y pego el texto: http://www.20minutos.es/noticia/567125/0/entrevista/placido/domingo/


Plácido Domingo: "Si mi nieto fuera 'heavy' le enseñaría mi música más que a nadie"




MIRENTXU MARIÑO. 16.11.2009 - 19.06 h

Hasta dentro de algo más de seis meses el tenor Plácido Domingo no volverá a pisar las calles de su ciudad natal. Traerá entonces de la mano al personaje que hace sólo unos días le valió 25 minutos de aplausos en Berlín, el Simón Boccanegra de Giuseppe Verdi.

Durante su fugaz paso por Madrid, la semana pasada, presentó
su nuevo trabajo discográfico, Amore Infinito, una recopilación de canciones basadas en poemas del fallecido Papa Juan Pablo II y en el que colaboran su hijo Plácido, el italiano Andrea Bocelli o el estadounidense Josh Groban, entre otros.

A sus 68 años, el también director de orquesta es capaz de tumbar de cansancio al séquito que le acompaña -"no se cómo aguanta", comentan incrédulos a su alrededor-; su agenda, casi completa hasta el año 2012, no tiene un mínimo hueco libre entre funciones, salvo para ocasiones especiales y casi siempre relacionadas con el fútbol, la otra gran pasión del artista.

Por eso,
20minutos.es aprovechó un rutinario trayecto en coche
para hacerle una entrevista poco usual. La primera pregunta era obvia.

Lo del Alcorcón y el Real Madrid fue una de esas cosas insólitas que pasan, pero lo que no tiene remedio es mejor parar de comentarlo.
Dadas las circunstancias, hágame un diagnóstico del Real Madrid.
Pues nada, que el balón es redondo, unas veces entra y otras no… y no ha querido entrar. Pero yo estoy con mi equipo en las buenas y en las malas. Hemos perdido la Copa del Rey, pero hay mucha liga y espero que el 22 de mayo el Real Madrid gane su décima Copa de Europa en el Bernabéu. Tan fácil como eso (risas). Hay un equipo que lo puede hacer todo, pero el hecho de que Cristiano haya estado lesionado ha influido mucho. Y es un momento difícil, pero creo que se va a superar. Lo del Alcorcón fue una de esas cosas insólitas que pasan, pero lo que no tiene remedio es mejor parar de comentarlo...




¿Qué le ha dado más disgustos, el deporte o el trabajo?
Yo creo que el deporte, porque me lo tomo muy a pecho (risas). En la profesión hay momentos difíciles, pero la verdad es que tengo unas satisfacciones tan grandes… Este año he seguido, por ejemplo, los partidos de Pau Gasol en Los Ángeles; y siento una gran rabia por Alonso, que finalmente está en Ferrari después de que le hicieran algo tan tremendo en la McLaren. Si eso no hubera sucedido, hoy sería campeón del mundo por lo menos cuatro veces. Estas cosas me llegan.


Berlín le brindó hace unos días 25 minutos de aplausos tras cantar como barítono Simón Boccanegra. ¿Qué sintió?
El aplauso del público es algo que te llena de emoción, es increíble. Yo tengo en el (libro)
Guinness
un récord de una hora de aplausos, y ya no sabes qué hacer cuando sales al escenario. Pero eso va de público a público: por ejemplo, el de Londres no suele querer entretener tanto al artista, pero la ovación que te pegan en diez minutos no se te olvida en tu vida. El alemán quiere hacerte ver que saben mucho y te lo aprecian con todo el tiempo del mundo. Y el público de Viena suele estar en su casa en un máximo de 15 minutos, pero el de Nueva York se pasa tres cuartos de hora sacando el coche del garaje y llegan a casa hora y media después. El aplauso que te dan es menor pero igual de legítimo, va en relación con las ciudades y los caracteres.

Cuando uno está en la cima, ¿se relaja o sigue trabajando duro?
Se trabaja siempre, nunca puedes relajarte, porque sabes que cada cuatro o cinco días tienes que dar la cara ante el público. Esperan con ilusión lo que vas a hacer, han comprado las entradas con antelación, han hecho planes, las señoras van a la peluquería, el marido sale antes del trabajo, etc. Son muchas preparaciones y ante eso tienes que dar lo mejor que tienes.



¿Cómo surgió el proyecto de Amore Infinito?
Un día me pidieron que cantase un himno a la paz, contra la guerra, en Italia. Y para mi sorpresa vi que el texto era de Wojtyła. Yo ya había cantando para el Papa en México o en Nueva York, y lo había conocido en una audiencia privada con mi familia, pero después de aquello nos llamó al Vaticano para agradecérnoslo y se me ocurrió preguntarle si le gustaría que a algunos de sus otros poemas se les pusiera música. Y me dijo que sí. Ese fue el último día que lo vi, poco antes de su muerte. Así que hablé con mi hijo Plácido, que es compositor, y empezamos a crear esta idea. Primer buscamos tres poemas muy clásicos basados en la Biblia, y cuando íbamos a grabar pensé que tenía que haber una poesía que nos hablara más del Juan Pablo II al margen de la religión católica. Y la encontramos, poemas de un gran valor, con crítica; Juan Pablo II escribió muchos poemas dedicados a los obreros, al sufrimiento del pueblo polaco. Digamos que no es un disco que sea sólo para los católicos, sino para los que han admirado a este personaje.


¿Cuánto tiene la música de religión?
No tiene mucho. En realidad, este es un disco popular, tiene el beat que a la gente le va a llegar. Son melodías pegadizas que incluso podrían ser clásicas, y esa es la mezcla que buscábamos.


Pasa más tiempo fuera que dentro de casa ¿no le riñe su familia?
No, porque entienden muy bien mi vida. Mi mujer era cantante, es directora de escena y productora, y así crecieron mis hijos. También mis padres solían viajar siempre. Yo vivo entre Los Ángeles, Nueva York y Washington, pero de repente me paso, como ahora, un mes en Berlín o en Milán. Depende de dónde tenga producciones largas.

En EE UU antes veían a la vieja Europa, pero ahora las opiniones de Obama son muy diferentes a las que tenía Bush. Lo que pasa es que no todo se puede arreglar en un año¿Qué perspectiva del mundo se tiene desde un país como EE UU?
La pregunta quizá sería qué perspectiva tenemos en Europa sobre ellos (risas). Se están dando cuenta de que la Unión Europea tiene una importancia económica y social, y un poder extraordinario. EE UU está en un momento de crisis, y además China e India están creciendo, así como Brasil. Antes veían a la
vieja Europa
, pero ahora las opiniones de Obama son muy diferentes a las que tenía Bush. Lo que pasa es que no todo se puede arreglar en un año. Obama va a necesitar tiempo, y ojalá se lo den, porque lo más difícil para un presidente de allí es el Senado, donde se decide qué le dejan hacer y qué no...

¿El concepto elitista de la ópera es cosa del pasado?
Vamos a decir que la ópera ha evolucionado mucho, hay un repertorio mayor, hay más teatros y una inmensidad de cantantes con más oportunidades que las que teníamos antes. Pero la ópera es cara, cuesta mucho. Hay un público que quisiera ir y no puede, y eso no sé cómo se va a arreglar. Quizá la solución sería que unos arquitectos junto a unos especialistas en acústica pudieran construir teatros más grandes, con 3.000 o 4.000 localidades; eso podría abaratar el precio.


Si un nieto le saliera heavy, ¿qué haría?
Respetaría mucho lo que él quisiera hacer, pero le aconsejaría y le enseñaría más que a nadie mi música (risas).

A pesar de lo trágico de muchos de sus personajes, ¿a cuál le tiene más cariño?

Es muy difícil escoger, es como si tienes siete u ocho hijos y te preguntan cuál es tu preferido. En cuanto a lo de las tragedias, yo suelo decir una frase:
Life is short, opera is long; Wagner longer, and the Ring, impossible…
(risas).

BIO. Nació en Madrid en 1941. Sus padres eran intérpretes de Zarzuela que emigraron a México cuando él tenía ocho años. Allí estudió piano, solfeo, canto, composición y dirección. Su madre, Pepita Embil, era de la localidad guipuzcoana de Getaria; "Me gustaría ser menos conocido para volver siempre que quisiera", confiesa el tenor, que recientemente ha debutado como barítono en una gran producción. Está casado desde 1962 en segundas nupcias con la soprano mexicana Marta Ornelas. Actualmente dirige las óperas de Washington y Los Ángeles

lunes, 16 de noviembre de 2009

Es aquí donde vive mi amor...

Estaba recordando ayer el musical de Frederic Loewe "My fair lady"... De perqueña, antes de que en el colegio nos enseñaran las primeras palabras en inglés, me preguntaba que querría decir "fair". Qué tiempos aquellos...


"Mi bella dama" o lo que es lo mismo "My fair lady" fue una de las primeras incursiones de Plácido Domingo en el mundo de la música. Para aquellos que admiramos su arte, esas "curiosas" intervenciones, se convierten en perqueñas joyas que guardamos (no en un joyero) porque con total seguridad no tendríamos espacio suficiente, pero sí que tienen un lugar especial en la estantería de cd, o cajas, o cajones (según la persona) y que sobretodo apreciamos por lo que significan para todos nosotros.


Hace un par de años encontré una pequeña gran joya:




"Mi bella dama" realizada en México en el año 1958 con Manolo Fábregas y Cristina Rojas. Entre el resto del elenco "pululaba" otra voz, un jovencísimo Plácido Domingo de 17 añitos que hacía, si no voy errada, uno de los amigos borrachos del padre de Eliza Doolittle. La versión vale realmente la pena por curiosa. A penas se le aprecia, pero está allí.

Sin lugar a dudas, "My fair lady" tiene momentos musicales sublimes y que ya aparecen el el preludio de la obra: la anglófona "I could have danced all night" y la mexicana "La calle donde vives".

En este vídeo podemos apreciar a Plácido Domingo cantar esta pieza primero en inglés y después en castellano tal y como explica perfectamente.

ON THE STREET WHERE YOU LIVE

I have often walked down this street before;
But the pavement always stayed beneath my feet before.
All at once am I Several stories high.
Knowing I'm on the street where you live.
Are there lilac trees in the heart of town?
Can you hear a lark in any other part of town?
Does enchantment pour Out of ev'ry door?
No, it's just on the street where you live!
And oh! The towering feeling
Just to know somehow you are near.
The overpowering feeling
That any second you may suddenly appear!
People stop and stare. They don't bother me.
For there's no where else on earth that I would rather be.
Let the time go by, I won't care if I
Can be here on the street where you live.

****************************************************************************************

LA CALLE DONDE VIVES

En tu calle estoy sin saber por qué,

Sin pensar camino y llego junto a tu balcón.

Es el corazón quien me trae aquí.

Es aquí donde vive mi amor.

Por primera vez me parece ver

Que los arboles florecen en invierno igual.

Que al llegar aquí ha salido el sol,

Es aquí donde vive mi amor.

Sentir que tú estás muy cerca,

Y saber que vives aquí.

Pensar que si abro la puerta,

En un momento tu sonrisa encontraré.

Al amanecer y al anochecer,

Hoy igual que ayer, mañana igual igual que hoy.

En tu calle estoy, no sé por qué.

Es aquí donde vive mi amor.

Al amanecer y al anochecer,

Hoy igual que ayer, mañana igual igual que hoy.

En tu calle estoy, no sé por qué.

Es aquí donde vive mi amor.

Sansón y Domingo y...

Tenía todos los ingredientes: el reproductor de DVD libre y la tele desocupada. Recién llegada del cine me dispuse a escuchar un ratito a Plácido, antes que el fútbol se adueñara otra vez de la televisión. Pero ni aún así. Porque hay un pero...
Después de tragarnos todo el sábado por la mañana el ruido insoportable de las obras que acechan nuestra ciudad, por lo visto no había sido suficiente.
"Sansón y Dalila" es un "bombón" del repertorio francés para la voz de tenor y Sansón ha sido un personaje que ha acompañado la carrera de Plácido Domingo al lo largo de toda su trayectoria como cantante de ópera.
He visto varias producciones, desde las más clásicas y conservadoras que recuerdan a las películas filmadas por Cecil B. de Mille en los años '50 y que yo, personalmente, añoro, hasta las más modernas o psicodélicas (como la producción del MET para celebrar los 30 años de debut del maestro en este coliseo americano); o la estridente también puesta en escena "scaligera" en Milán), pasando por otras mucho más austeras y sobrias (como la de finales de los años '80 en el Liceu de Barcelona, que si no me equivoco firmaba Giancarlo del Monaco y que por esto mismo me sorprendió).
A pesar de todo este bagaje, entre el cuál me dejo algunas otras producciones que escénicamente, simplemente funcionan, no he visto ninguna en directo.
Pues bien, como decía, con todos los elementos mí favor, me disponía a ver una grabación de varios vídeos seleccionados de Youtube, un DVD de "tastets" como yo los llamo. Las tres primeras piezas, más o menos se trampearon, pero al llegar al "Sansón"... la cosa cambió.
Una obra como la de Saint-Saëns, que describe escenas de misticismo, heroicidad, de tormenta, de suspense... pero también de seducción, logrando rozar un erotismo tan fino que hace que la escena que tienen Sansón y Dalila en el segundo acto, sea quizás, una de las musicalmente más completas y una de las preferidas del público.
Los intérpretes de este "tastet" de Sansón eran ni más ni menos que el citado tenor y la explosiva mezzosoprano Agnès Baltsa. Nos ponemos en situación: la escena delante nuestros ojos, todos inmersos en su "Mon coeur s´ouvre a ta voi", el clima de amor creado, los oyentes dentro de la escena, y "tacatacatacatacatacatacata" se ponen a las 7 y pico de la tarde del sábado a rebentar aceras....!!!!
Es que no hay derecho, ¡¡¡¡¡¡ni en sábado puedo escuchar a Domingo!!!!!!!
Este es el vídeo que me disponía a disfrutar:

Lo disfrutaremos desde aquí. Quien no se consuela...

Nueva portada de Plácido Domingo

Hace unos días soñé que en una revista de ópera dedicaban un reportaje de muchas páginas a Plácido Domingo y mirad por donde, el sábado me topé con él. Bien puesta en la estantería y de la que solo podía apreciar una cabeza con muchos hilos de plata.
Sin dudarlo dije "Es Plácido, es Plácido". Tiré de la revista y efectivamente, allí estaba esperándome.

Con vestiduras de su última y tan reciente creación aparecía elegante y la imagen tenía algo de especial. Si lo miras con detenimiento te das cuenta de que es una pintura y no una fotografía. Y además está tan bien lograda que engaña y te lleva a la duda.

Dentro hay 6 páginas dobles a todo color donde se puede apreciar al Maestro en algunos de sus personajes que lo han y lo acompañan al largo de su dilatada carrera.

El texto no descubre nada que los seguidores de Domingo no sepamos ya a estas alturas, pero es interesante verle reflexionar acerca del Simon.

Como curiosidad, hay comentarios de algunos de sus colegas, como Rolando Villazón o Thomas Hampson que hablan maravillas del tenor.
En fin, un número imprescindible para todos aquellos que adoramos su voz.

martes, 10 de noviembre de 2009

Plácido Domingo en la Fiesta de la Libertad en Berlín

Y como decía ayer en la entrada anterior, el tenor Plácido Domingo se unió a la fiesta berlinesa para conmemorar el vigésimo aniversario de la caída del muro de Berlín. De la mano del director Daniel Baremboim que invitó al tenor personalmente, interpretó una distendida pieza que animó a todos los pólíticos reunidos en el acto: Angela Merkel, Sarkozy, Zapatero...

Y para la ocasión salió "requeteguapete" (con todo el cariño del mundo, Maestro), con su traje oscuro a juego con la corbata, chaleco y camisa blanca.

lunes, 9 de noviembre de 2009

20 años de la caída del muro de Berlín

Hoy se celebra en Berlín el 20 aniversario de la caída del muro, uno de los acontecimientos que más recuerdo de mí infancia, ya que en su día me impactó mucho la imagen del muro. Siempre quise saber qué había detrás del muro, pero también dentro, su grosor, etc... Curiosidades.

Acabo de ver ahora mismo en las notícias de TVE1 que para conmemorar este aniversario se ofrece un concierto bajo la dirección de Daniel Barenboim, donde se interpretarán obras de Wagner y Schömberg. Además, participará también el tenor Plácido Domingo. Si ya me lo pensaba, ya, Plácido en Berlín... y ayer en las notícias anunciaron la actuación de Baremboim... el resultado era obvio: Plácido Domingo pondrá su granito de arena en la celebración de estos actos dejando huella en la historia de Alemania.




Y es que debe hacer un frío en Berlín...porqué Domingo iba con una señora bufanda en el cuello. Además creo que por la web de TVE se podrá ver a partir de las 18.30h. los actos en directo.
Si os interesa, mañana martes en la 2 a las 10 de la noche se pasa un documental titulado "Berlín, 20 años después". Tiene pinta de ser interesante.

martes, 3 de noviembre de 2009

Rectificar es de sabios y de los errores se aprende.

Con esta entrada quiero hacer una rectificación de algo que puse de manera incorrecta en una de las entradas de este blog.
Tengo que hacer referencia a la siguiente entrada: "¡Al abordaje. Los piratas desembarcan en Sabadell!, donde en ella me refería a EZEQUIEL CASAMADA que interpretó en la Faràndula de Sabadell el papel de Itulbo en la ópera "Il Pirata" y decía que en el programa de mano ponía que era tenor, y no barítono y en reaidad yo lo tenía "encasillado" como barítono.
Pues bien, un "pajarito" me ha dicho que no, que es tenor porque su tesitura ha hecho un cambio. Por esto mismo, quiero pedir disculpas por el patinazo, y que quede claro que Ezequiel es tenor. "Mea culpa" y mil disculpas por otorgarle otra tonalidad.
Grácias también al "pajarito" por hacerme salir de mí error.

domingo, 1 de noviembre de 2009

Siempre me quedará el tenor

Haciendo quizás un poco de plagio de la famosa frase de la célebre película "Casablanca" en la que Bogart decía a Ingrid Bergman "Siempre nos quedará París...", yo digo lo mismo acerca de la escucha del reciente debut de Plácido Domingo en el "Simon Boccanegra" de Berlín: "Siempre nos quedará el tenor..."

No conozco lo suficiente, a nivel musical, la citada obra de Verdi, pero creo, que conozco bastante la voz de Plácido Domingo.
Para ser completamente objetiva con su interpretación y no tener prejuicios a la hora de opinar, tan solo he leído la crítica (que firmaba Rubén Amón) y que publiqué la semana pasada en este rincocito dedicado, precisamente, a este tenor, pero también a la ópera en general. Sé que tuvo un gran éxito y una acogida tremenda (como no podía ser de otra manera). Y me alegro por él, y a pesar de estar físicamente en la distancia, mí corazón estuvo en Berlín el sábado pasado.


Como decía anteriormente, no puedo juzgar una obra que no he escuchado lo suficiente, ni hablar acerca de las otras voces y decir si eran o no adecuadas y ajustadas al papel porque estaría escribiendo algo de lo cual no puedo opinar por desconocimiento. Pero acerca de la voz de Plácido sí que puedo o creo, que puedo opinar si se me permite.

Me gusta la voz de Plácido Domingo (no es un secreto), cante lo que cante y como lo cante porque siempre encuentro algo positivo en su trabajo. Evidentemente esto es algo que de entrada ya tengo ganado.
Lo he escuchado en la tesitura de barítono y obviamente, en la de tenor. Y Plácido ES TENOR a pesar de que cante con tonalidades más bajas. Al menos me quedo yo con esta idea.

Que me perdone el Maestro Domingo si entro ahora en este tema (del cual él, mejor que nadie, podría hablar), pero quiero ser fiel conmigo misma, y con mí oido y sobretodo con el trabajo que ha realizado el tenor: y es que, aunque cante de barítono, me suena siempre a tenor. Es más, siempre que escucho la voz de tenor, espero encontrarme a él: ese apasionamiento único y característico que te hace tocar la gloria en todas sus intervenciones.

A decir verdad, tampoco he encontrado muchas diferencias respeto a las últimas obras que le he escuchado en vivo (entiéndase Luisa Fernanda -como Vidal; Walkyria -Siegmund en Barcelona y Valencia; Iphigenia en Tauride-como Orestes en Valencia).

Si bien en la segunda era una tesitura tenoril - a pesar de algún pasaje puntual- no exige una endiablda tesitura y en el resto de obras canta en un registro baritonal. Por este motivo, y quizás porque ahora estoy acostumbrada a escucharle en esta tonalidad, en este "Simon" he reconocido al Plácido de los últimos 3 o 4 años donde se puede identificar automáticamente su timbre característico y su color tenoril.
Me quedan aún muchas audiciones de esta obra para juzgarla tal y como se merece, pero el primer contacto con ella es positivo. Aún así, me quedo con el Plácido tenor y con sus notas centrales que nadie ha superado.